Epstein-Barr virus (EBV) has been strongly linked with African Burkitt’s lymphoma and nasopharyngeal carcinoma (NPC) and has recently been associated with breast cancer (1). Nine studies of EBV in breast cancer with the use of different methods (1–9) present conflicting results.

In the current study, microdissected ductal breast carcinomas were tested for EBV. Only one of 115 cases was positive. This finding stands in contrast to results of studies of ductal carcinoma showing up to 48% EBV positivity by polymerase chain reaction (PCR). Bonnet et al.(1) found 51 of 100 breast cancers of all types to be PCR positive for EBV. EBV positivity was also shown by Southern blot analysis and immunostain in a subset of cases, but in situ hybridization (ISH) for EBER was negative. A similar pattern has been observed previously (2). Our study included 115 breast cancers, chosen for having microdissectable normal, as well as intraductal, invasive, or metastatic tumor components. Intraductal carcinoma specimens were obtained from 84 patients, invasive tumor in 106 patients, metastases in 50 patients, and recurrences in six. Normal lymph node or other normal tissue was also collected, for a total of 361 samples (10). Institutional approval was received for the conduct of the study. Samples were analyzed by 5-nuclease PCR for the EBNA1 gene. Primers were CTGGAAATGGCCTAGGAGAGAA (nucleotides 637–658; GenBank S45894) and TCCATGGTTATCACCCCCTC (nucleotides 709–728), and the probe was FAM-AGACA-